N12B-2

Skapa släktträd för elva fåglar utifrån sekvensjämförelser.

Ni har utifrån utseende skapat ett släktträd med elva fågelarter.  Nu ska ni jämföra det släktträdet med det träd man får fram om man gör DNA-analyser av en gen kallad cytochrom C-oxidas 1 (som finns hos alla djurarter). I listan nedan finns en del av den genen hos de elva fågelarter ni arbetat med.

1. Kopiera hela listan. Börja med raden ”>Kaja (Corvus monedula)” och sluta där den sista raden med atcg:n slutar.

2. Gå till http://www.genome.jp/tools/clustalw/

3. Klistra in sekvensen i den stora rutan (se pil nedan)

4. Strax ovanför rutan, klicka för ”DNA”

5. En liten bit nedanför rutan, klicka på ”Execute Muliple alignment”-knappen.

6. I rutan högt upp på sidan som då kommer, välj ”Unrooted phylogenetic three with branch length (N-J)”. Klicka på  ”Exec”-knappen.  Spara den bild som kommer till labbrapporten.

7. Välj också ”Rooted phylogenetic three with branch length (UPGMA)”, och spara bilden.

Lista med del av genen cytochrome C oxidase 1 hos elva fågelarter

>Kaja (Corvus monedula)

tctgtaccta atcttcggag catgagccgg aatagtaggt accgccctaa gtctccttat ccgagcagaa ctaggacaac caggtgctct tctaggagac gaccaaatct ataatgtaat tgttacagcc catgctttcg tcataatctt cttcatagta atgccaatta taatcggggg attcggaaac tgactagttc ccctaataat tggagcccca gacatagcat tcccacgaat aaacaacata agcttctgac tacttcctcc ctcattcctt cttcttctag cttcttctac agtagaagca ggagcaggaa caggatgaac tgtataccca ccactagctg gtaatatagc ccacgccgga gcctcagtcg acctagctat cttctcacta cacctagcag gtatttcctc aatcctaggg gcaattaact ttattactac agcaatcaac ataaaacctc cagctctatc acaataccaa acccctctgt tcgtatgatc cgtactaatt accgcagtac tactccttct atctctacct gtacttgctg ccgggattac catgctacta acagaccgaa acctcaatac cacattcttc gatccagcag gaggaggaga cccagtacta taccaacacc tattctgatt cttcggacac ccagaagttt acatcctaat tcta

>Bofink (Fringilla coelebs)

cctataccta attttcggcg catgagccgg aatagtgggt accgccctca gcctcctcatccgagcagaa ctgggccaac ccggagctct tctaggagac gaccaagtct acaatgtagt tgtcacggcc catgctttcg taatgatttt ctttatagtt atgcctatta taatcggagg gttcggaaac tgattagttc ccctgataat tggagccccc gacatagcat ttccccgaat aaataacata agcttctgac tacttccacc atcttttctc cttctactag catcctccac cgtagaagca ggagtaggta caggatgaac cgtatatccc ccactagccg gcaatctggc ccacgctgga gcctcagtag acctagcaat cttttcatta cacctagccg gcatctcttc aatcctagga gcaatcaact tcatcacaac agcaatcaac ataaaaccac ctgccctatc acaataccaa acccccctat tcgtatgatc cgtcctaatc actgcagtac tcctcctcct atctctgcca gttctcgctg cagggattac aatgcttctc acagatcgta acctcaatac tactttcttt gaccccgcag gcggaggaga ccctgtacta taccaacacc tgttctgatt ctttggccac cccgaagtat acatcctaat cctc

>Grönfink (Carduelis chloris)

cctatattta attttcggcg catgagccgg gatagtaggt actgccctaa gtcttctcat ccgagcagaa ttaggccaac ccggagccct tctaggcgac gaccaagtct ataacgtagt cgtcacagcc catgcttttg taataatttt cttcatagtc atacccatca taattggggg attcggaaac tgactagttc ctctaataat cggagcccca gacatagcat tcccacgaat aaacaacata agcttctgac tacttcctcc atctttcctg ctgctactag catcttccac tgtagaagca ggtgttggca caggttgaac agtatacccc ccactagctg gcaacctagc ccatgctgga gcttcagttg acttagcaat cttttcccta catttagccg gtatctcctc aatccttggg gcaatcaact tcattacaac agcaattaac ataaaacctc ctgccctatc gcaataccaa acccctctat tcgtctgatc agtcctaatc actgcagtac tcctacttct ctccctccca gtccttgctg caggaatcac aatgcttctt acagaccgca acctaaacac cacattcttc gaccccgcag gaggaggcga cccagtccta taccaacatc tcttctgatt tttcggtcac ccagaagtat atatccttat cctc

>Rödstjärt (Phoenicurus phoenicurus)

cctctattta attttcggcg catgagccgg aatagtgggc actgccctaa gcctcctcat ccgagcagaa ctgggccaac ctggcgccct actaggagac gaccaagtct acaacgtagt cgtcacagcc catgctttcg taataatctt cttcatagtt atgccaatta taatcggagg atttggaaac tgactagttc ccctaataat cggagctcca gacatagcat tcccccgaat aaacaacata agcttctgac ttcttcctcc atcgttccta ctcctcctag cctcttctac agtcgaagca ggggcaggga caggctgaac tgtatatcct cctctcgccg ggaacctagc tcatgctgga gcttcagtag acctagccat cttctccctc cacctagcag gtatctcctc catcctaggt gccatcaact ttatcactac agcgatcaac ataaaaccac ccgccctttc acagtaccaa acccccctat tcgtctgatc cgtcctaatc acagcagtcc tacttctcct atccctgcct gttcttgccg ccggcattac catgctcctc acggaccgta acctaaacac taccttcttt gacccggcag gaggaggaga ccctgtactc taccaacacc ttttctgatt tttcggacac ccagaagtat acatcctaat tctc

>Björktrast (Turdus pilaris)

cctctacctg atcttcggtg catgagccgg gatagtgggt acagccctaa gtctccttat tcgagcagaa ttaggccaac caggtgcgct actaggtgac gaccaaatct acaacgtagt tgttaccgcc catgctttcg taataatctt cttcatagtt atgccaatta taatcggagg gttcggaaac tgactagtcc ccctaataat cggagcccca gacatagcat tcccccgaat aaacaacata agcttttgac tcctcccccc atccttcctt ctcctcctag cctcctctac agtagaagct ggagcaggaa caggttgaac cgtatatccc cccctcgccg gcaatctagc acatgcaggg gcttcagtag acttagccat cttctcccta cacctagcag gaatctcctc aatcctaggg gctatcaact tcatcacaac agcaatcaac atgaaaccac ctgccctctc acaataccaa acccccctat tcgtctgatc agtcctaatc actgcagtac tgctcctact atccctcccc gtccttgccg ctggtattac tatgctcctc accgaccgta accttaatac aaccttcttc gaccctgcag ggggagggga cccagtacta taccagcacc tcttctgatt ctttggccac cccgaagtct atattctcat cctc

>Koltrast (Turdus merula)

tctctaccta atcttcggcg catgagccgg aatagtaggt actgccctaa gcctccttat tcgagcagaa ctaggccaac caggtgccct actaggtgat gaccaaatct acaacgtggt tgtcaccgcc catgcttttg taataatctt cttcatagtt ataccaatca tgatcggagg gttcggaaac tgactagtcc ccctaataat cggagcccct gacatagcat tcccccgaat aaacaacata agcttttgac tcctcccccc atccttcctc ctcctcctag cctcctctac agtagaagct ggagcaggaa caggttgaac cgtctatccc cccctcgccg gcaatctagc acatgcaggg gcttcagtag acttagctat cttctcccta cacctcgcag gaatctcctc aatcctgggg gctattaact tcatcacaac agcgatcaac ataaaaccgc ctgccctatc acaataccaa acccccctat tcgtctgatc agtcctaatc actgcagtac tactcctact atccctcccc gtccttgctg ctggcatcac tatgctcctc accgatcgca acctaaacac aaccttcttc gacccagcag gaggaggaga cccagtacta taccaacacc tattttgatt ctttggccac cctgaagtct acatccttat cctc

>Ormvråk (Buteo buteo)

cctataccta atcttcggtg cctgagccgg tatagtcggc accgccctca gcctacttat tcgtgcagaa ctcggccaac caggcacact cctaggtgac gaccagatct acaacgtaat cgttaccgca catgccttcg taataatttt ctttatagtt ataccaatta tgatcggagg cttcggaaac tgacttgttc cactcataat cggcgccccc gatatagcct tcccacgcat aaacaacata agcttctgac tacttcctcc atcctttctc ctcctcctag cctcctcaac agtagaagca ggagccggca ctggatgaac tgtctatccc ccactagctg gcaacatagc ccatgccgga gcttcagtag acctagccat cttctccctc cacttagccg gagtctcgtc cattctagga gcaatcaact ttatcacaac cgccatcaac ataaagcccc cagccctctc ccagtaccaa acacccctat tcgtatgatc tgtcctcatt accgctgtcc ttctactact ctcactccca gtcctagccg ccggcattac tatactactt acagaccgaa acctaaacac aacattcttt gaccccgccg gcggaggtga tcctatccta taccaacatc tcttttgatt ctttgggcac ccagaagttt acatcctaat ccta

>Sparvhök (Accipiter nisus)

cttatactta atctttggcg cttgagccgg catagttggt actgccctta gcctgctcat tcgcgcagaa cttggccaac caggcacact cctaggcgat gaccaaatct ataatgttat cgtcaccgca catgctttcg taataatttt cttcatagtt atgccaatca taattggggg cttcggaaac tgactcgtcc cactcataat tggcgcccct gacatagcct tcccacgcat aaataacata agcttctgac tactcccccc atcattcttc ctattactag cctcttcaac agtagaagca ggagcaggta ccggatggac tgtctaccct ccattagctg gtaacatagc ccatgccgga gcctcagtag acctagctat cttctcacta cacctagcag gaatttcatc catcctaggg gcaattaact tcatcacaac cgctattaac ataaaacccc cagccctctc ccaataccaa acacccctat tcgtatgatc cgtccttatc actgctgtcc tcctattact ctcactacca gttctagctg ctggtatcac catactacta acagaccgaa accttaatac aacatttttc gaccctgctg gtggaggtga ccccatccta tatcaacacc tcttctgatt cttcggacac ccagaagttt atattctcat tcta

>Duvhök (Accipiter gentilis)

cctatattta atctttggcg cttgagccgg catagtaggc actgccctca gcctcctcat ccgcgcagaa ctcggtcaac caggtacact actaggcgac gaccaaatct acaatgtaat cgtcaccgca catgccttcg taataatctt cttcatagtt ataccgatca taattggagg cttcggaaac tgacttgttc cgctcataat tggcgccccc gacatagcct tcccacgcat aaacaacata agcttctgac tactcccccc atctttcctc ctcttactag cctcctcaac cgtagaagca ggagccggaa ctggatgaac tgtttaccct ccattagctg gcaacatagc ccatgccgga gcctcagtag acctagccat cttctcccta catctagctg gagtctcatc cattctagga gcaattaact tcattacaac cgccattaac ataaaacccc cagccctttc ccaataccaa actcccctat tcgtatgatc agtcctcatt accgccgtcc tactactgct ctcacttcca gtcctagctg ccggcattac catactacta acagatcgaa acctcaacac aacattcttc gaccctgccg gtggaggcga ccccatccta tatcaacatc tcttctgatt cttcggccac ccagaagtct acatcctaat tcta

>Silvertärna (Sterna paradisaea)

cctttaccta attttcggcg catgagccgg tatagtgggc actgccctta gcctactcat tcgcgcagaa ctaggccaac caggaaccct cctaggagat gaccaaatct ataacgtaat cgtcaccgcc cacgcctttg taataatctt cttcatagta atacccatca taattggggg cttcggaaac tgattagtcc cacttataat tggtgccccc gacatggcat tcccgcgcat aaacaacata agcttctgac tgcttcctcc atcattctta cttctcctag cctcctctac agtagaggct ggagcaggca caggatgaac tgtatatccc cctctagctg gtaatctagc ccatgctggg gcttcagtag acttggcaat cttctccctc cacctagcag gtgtgtcctc tatcctgggt gctatcaact ttatcaccac ggccatcaac ataaaacccc ctgccctttc acaataccaa acccctctat ttgtatgatc agtacttatc actgccgtcc tactactact ctcgctccca gtactcgccg ccggcatcac tatattatta acagaccgaa acctaaacac aacgttcttt gaccctgctg ggggtggtga ccctgtacta tatcaacacc tattctgatt ttttggtcac ccagaagtat atatcttaat ctta

>Sillgrissla (Uria aalge)

accctgtatn taatctttgg cgcatgagct ggtatagttg gtaccgccct aagcctgctc atccgtgcag aactaggcca accagggacc ctcctaggag atgaccaaat ctataatgta atcgtcaccg cccacgcctt tgtaataatc ttcttcatag taataccaat catgattggt ggtttcggaa actgattagt cccactaata atcggtgcac ccgatatagc atttccccgt ataaacaata taagcttctg actattaccc ccatcattcc tactcctcct agcctcttcc acagtagaag ctggagctgg tacaggatga actgtatatc ctcccctggc tggtaatcta gcccatgccg gagcttcagt ggatttagca atcttctccc ttcacttagc aggtgtatca tctattctag gcgctatcaa ctttatcaca acagccatca acataaagcc tccagccctc tcacaatacc aaacccccct attcgtatga tcagtactta tcactgctgt cctactacta ctctcactcc cagtacttgc tgctggtatc actatattac taacagatcg aaacttaaac acaacattct ttgatccagc tggaggtggt gacccagtac tttaccaaca cctcttctga ttctttggtc atccagaagt atacatccta atcctac

En kommentar

  1. Peter Perskull
    Skrivet september 27, 2013 klockan 11:11 f m | Permalink

    Hej!
    Väldigt bra lab om systematik. Jag undrar lite om var du har fått sekvenserna för CytC. Jag har inventerat våra uppstoppade fåglar och hittade inte en sillgrissla i samlingarna. Det vore intressant att stoppa in en annan grissla eller någon tärna i dess ställe och kanske utöka trädet med några andfåglar.

    MvH
    Peter Perskull
    Gymnasielärare
    Vasaskolan, Gävle